90
|
Promega
pcbr-basic plasmid (for cbred construct) Pcbr Basic Plasmid (For Cbred Construct), supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/pcbr-basic plasmid (for cbred construct)/product/Promega Average 90 stars, based on 1 article reviews
pcbr-basic plasmid (for cbred construct) - by Bioz Stars,
2026-06
90/100 stars
|
Buy from Supplier |
90
|
Promega
cbred Cbred, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/cbred/product/Promega Average 90 stars, based on 1 article reviews
cbred - by Bioz Stars,
2026-06
90/100 stars
|
Buy from Supplier |
90
|
Promega
click beetle green cbg99 Click Beetle Green Cbg99, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/click beetle green cbg99/product/Promega Average 90 stars, based on 1 article reviews
click beetle green cbg99 - by Bioz Stars,
2026-06
90/100 stars
|
Buy from Supplier |
90
|
Promega
pcbg99-basic plasmid cbg construct Pcbg99 Basic Plasmid Cbg Construct, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/pcbg99-basic plasmid cbg construct/product/Promega Average 90 stars, based on 1 article reviews
pcbg99-basic plasmid cbg construct - by Bioz Stars,
2026-06
90/100 stars
|
Buy from Supplier |
94
|
Addgene inc
5 attatctagattactaaccgccggccttcaccaac 3 lentiviral vector fuw 5 Attatctagattactaaccgccggccttcaccaac 3 Lentiviral Vector Fuw, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/5 attatctagattactaaccgccggccttcaccaac 3 lentiviral vector fuw/product/Addgene inc Average 94 stars, based on 1 article reviews
5 attatctagattactaaccgccggccttcaccaac 3 lentiviral vector fuw - by Bioz Stars,
2026-06
94/100 stars
|
Buy from Supplier |